Informations

Remplacez les dNTP 25 mM par des dNTP 10 mM

Remplacez les dNTP 25 mM par des dNTP 10 mM


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'ai besoin de faire une solution de plusieurs composés, l'un d'eux est les dNTP. La recette demande 20 l de dNTP 25 mM dans un mélange maître de 1250 L. Malheureusement, je ne l'ai pas disponible à cette concentration, puis-je remplacer le mélange dNTP 25 mM par un mélange 10 mM ?

DÉTAILS TECHNIQUES

  • $dATP : C_{10}H_{13}N_5O_{12}P_3Na_3 - MW=557.2$
  • $dCTP : C_9H_{13}N_3O_{13}P_3Na_3 - MW=533.1$
  • $dGTP : C_{10}H_{13}N_5O_{13}P_3Na_3-MW=573.2$
  • $dTTP : C_{10}H_{14}N_2O_{14}P_3Na_3-MW=548.1$

Serait-ce 50 L de dNTP 10 mM pour remplacer les 20 L de dNTP 25 mM ?


Oui, vous pouvez le faire. Tant que le mélange final a les bonnes concentrations de tout, tout va bien. Assurez-vous simplement de compenser en ajoutant 30 ul (le volume supplémentaire) d'eau en moins au mélange principal.


Vivantis Technologies Sdn Bhd

Accueil Échelles/ Marqueurs/ Acides nucléiques/ Nucléotides Nucléotides Mélange dNTP

Votre recherche : dNTP

Avantor ®, une société Fortune 500, est l'un des principaux fournisseurs mondiaux de produits et services essentiels aux clients des secteurs de la biopharmacie, de la santé, de l'éducation et du gouvernement, des technologies de pointe et des matériaux appliqués. Notre portefeuille est utilisé dans pratiquement toutes les étapes des activités de recherche, de développement et de production les plus importantes dans les industries que nous servons. L'une de nos plus grandes forces réside dans le fait d'avoir une infrastructure mondiale stratégiquement située pour répondre aux besoins de nos clients. Notre présence mondiale nous permet de servir plus de 225 000 sites clients et nous donne un accès étendu aux laboratoires de recherche et aux scientifiques dans plus de 180 pays. Nous mettons la science en mouvement pour créer un monde meilleur. Pour plus d'informations, visitez www.avantorsciences.com et retrouvez-nous sur LinkedIn, Twitter et Facebook.

&copier 2021 VWR International, LLC. Tous les droits sont réservés.
© 2021 FORTUNE Media IP Limited Tous droits réservés. Utilisé sous licence.

Votre version d'Internet Explorer n'est pas prise en charge par ce site Web. Nous vous recommandons de passer à Internet Explorer 11 ou à un autre navigateur pris en charge, et de vérifier si vous utilisez IE11 dans Mode d'affichage de compatibilité.


Commenter

Merci. Non, ce n'est pas une question de devoirs. Je suis un doctorant de 50 ans en Entomologie dont le cerveau ne fait pas de maths, surtout de conversions. Je n'ai pas eu de cours de chimie depuis 10 ans.
Nous avons récemment dû changer de fournisseur pour nos apprêts. Les anciennes amorces contenaient des dNTP alors que les nouvelles n'en contenaient pas. Je dois donc ajouter des dNTP .2mM à mon mélange PCR sélectif. Je pense que je l'ai. Multipliez la concentration que je veux (.2mM) X le volume total (10uL) et divisez par la concentration du stock (2.5mM). J'ajouterais donc .8uL, n'est-ce pas ?
Merci pour ton aide

Salut, bonne chance pour l'étude, je ne suis pas très bon en maths non plus. Bravo à vous de vous asseoir et de simplement y travailler. C'est tout ce que vous pouvez faire avec ces problèmes, continuez simplement à vous débrouiller jusqu'à ce que vous le compreniez.

Je suis un peu flou sur la biologie, est-ce une extraction d'ADN ? - Certaines des personnes avec qui je travaille seraient horrifiées que je ne sache pas


Mélange dNTP 25 mM chacun [emballage en vrac : 25 ml]

La qualité de nos produits est très importante pour nous, et nous fournirons tout notre soutien pour nous assurer qu'ils fonctionnent comme décrit. Si un produit ne fonctionne pas correctement, veuillez nous contacter immédiatement. Nous contacterons le fabricant pour fournir des conseils d'experts dans le but de résoudre le problème. Nous pouvons exiger des détails de votre protocole pour nous assurer que les procédures correctes ont été suivies. Si les procédures correctes ont été suivies et que l'article ne fonctionne pas comme décrit, un remplacement ou un remboursement sera proposé.


Si les articles sont commandés de manière incorrecte, le client peut être soumis à des frais de restockage de 20 % sur les articles ainsi qu'à tous les frais d'expédition, de manutention et d'emballage.

Dans le cas improbable de réception d'un article incorrect, veuillez stocker l'article comme indiqué et contactez-nous immédiatement à [[email protected], Tél : +82-2-70-8615-5557]. Nous prendrons des dispositions pour nous assurer que vous recevez le bon article et que le mauvais article est récupéré auprès de vous.


J'ai écrit un protocole PCR en tant que personne qui n'a jamais tenu de pipette auparavant [x-post r/bioinformatics]

En tant que personne qui a eu du mal avec les PCR ces derniers temps. Je pense que mon problème est que la journée se termine par un "y".

Eh bien, avez-vous installé le sanctuaire approprié autour de votre thermocycleur ? Et avez-vous sacrifié le bon petit animal ?

qu'essayes-tu de faire avec la PCR ?

Certains commentaires depuis que j'ai fait une tonne de PCR, certains d'entre eux sont définitivement pointilleux mais je pensais juste les mentionner.

Vous pouvez mentionner que les dNTP' sont parfois inclus dans le tampon Taq.

J'ajouterais quelque chose dans cette section sur la spécificité : votre amorce doit se lier à la séquence cible souhaitée et à aucune autre séquence du génome de l'espèce que vous utilisez (la conception de l'amorce est un tout autre sujet).

NE JAMAIS laisser la Taq Polymerase atteindre la température ambiante.

Ce ne serait pas la fin du monde, je veux dire, le Taq survit à la PCR à des températures allant jusqu'à 95 ° C s'il atteint la température ambiante pendant une minute ou deux, il ne devrait pas le tuer.

Brièvement vortexer et centrifuger

J'ai l'habitude de simplement feuilleter / inverser les tubes quelques fois, puis de faire tourner les impulsions dans l'un d'entre eux. Certaines enzymes disent qu'elles ne devraient pas être vortexées. Plus de discussions.

Ajouter entre 0,5 et 2,0 unités de polymérase par réaction de 50 ul

La Taq peut être ajoutée aux mélanges maîtres, elle n'a pas besoin d'être ajoutée individuellement à chaque réaction PCR (en parlant de cela, j'ajouterais des informations sur la préparation des mélanges maîtres PCR car c'est comme cela que cela se fait habituellement, plutôt que d'ajouter des réactifs à chaque tube PCR individuellement. Un diagramme/tableau serait utile ici).

J'ai vu une certaine confusion avec l'étiquetage des dNTP en ce qui concerne la concentration. Fondamentalement, 100mM dNTP's contient 25mM de chaque NTP individuel, et j'ai vu des tubes dans ces situations étiquetés 100 ou 25 même s'ils contiennent exactement la même chose.

Assurez-vous que le couvercle est aussi serré que possible

Attention ici, vous pouvez facilement serrer le couvercle au-delà de l'endroit où il doit être serré et écraser vos tubes. Au lieu de cela, vous devez serrer jusqu'à ce que vous sentiez une résistance (du couvercle en contact avec le haut des tubes), puis serrez un autre 1/4-1/2 tour.

S'assurer qu'il y a un pas de stockage infini à moins de 5°C après la fin du cycle final

Cela a déjà été mentionné, mais une température plus élevée (10-15 °C) fonctionnera bien et empêchera la condensation et moins d'usure sur la machine PCR, et en fait, la plupart des produits PCR seront stables à température ambiante pendant des jours.

Les températures de recuit spécifiques dépendent des amorces et une température recommandée serait fournie par le fabricant.

Bien qu'en réalité, cela doive souvent être déterminé de manière empirique, car les calculs de température de recuit d'amorce ne sont pas fiables à 100 %.


Remplacez les dNTP 25 mM par des dNTP 10 mM - Biologie

DES SCIENTIFIQUES TRAVAILLANT POUR DES SCIENTIFIQUES

G-Biosciences est un laboratoire des sciences de la vie certifié ISO 9001:2015 et conforme aux cGMP, expérimenté dans la recherche et la fabrication universitaires et industrielles. Nos réactifs de haute qualité sont cités dans plus de vingt mille publications, un nombre qui ne cesse de croître. Notre objectif est de fournir des réactifs, des produits chimiques spécialisés, des tampons, des tests, des kits d'application et des outils de recherche simples à complexes.

Nos connaissances approfondies en recherche, développement et fabrication nous ont permis de développer des produits pour de multiples domaines de recherche, notamment la protéomique, les acides nucléiques, les immunotechnologies, les essais biologiques, la biologie cellulaire et les essais de santé cellulaire. Faire de G-Biosciences un guichet unique pour vos fournitures de recherche, vos outils et vos besoins de fabrication sur mesure. De plus, nous avons développé plus de 70 kits pédagogiques pratiques pour les enseignants et nos futurs chercheurs.

Nous proposons une fabrication sur mesure et OEM experte et de qualité supérieure qui répond aux exigences strictes cGMP de l'industrie biotechnologique. Nous offrons des services de marque privée autour de notre gamme complète de capacités de fabrication de réactifs réalisées par des professionnels hautement qualifiés, y compris la fabrication sur mesure, la synthèse de résine de purification et la production d'amplis et le remplissage de colonnes.


Méthode d'isolement d'ARN poly A+ recommandée

L'ARNm doit être extrait d'aliquotes de 200 µg d'ARN total en utilisant Qiagen Oligotex Mini Préparation (avec 15 & microL de billes oligotex) selon les protocoles des fabricants.

  1. Pour l'élution finale, il est préférable de s'assurer que les billes sont à 70°C lors de la centrifugation. Nous avons obtenu des rendements plus élevés en incubant l'échantillon et la colonne à 70°C pendant 5 minutes.
  2. Rendements attendus compris entre 2 et 5 µg à partir de 200 µg d'ARN total.

Remplacez les dNTP 25 mM par des dNTP 10 mM - Biologie

Détails sur les sondes (pour plus de détails, voir les informations sur la bibliothèque) :

Bibliothèque BAC CEPH . Vecteur : pBeloBAC11. Résistance : Cloramphénicol 12,5 ug/ml
séquençage final :
T7 GTAAAACGACGGCCAGT
SP6 AGCGGATAACAATTTCACACAGG
----------------------------------------------------------

BAC de P.dejong : Vecteur : pBACe3.6 (11,49 kb). Résistance : Cloramphénicol 12,5 ug/ml
fin de séquençage ( même nom séquence différente !! ):
T7 CGGTCGAGCTTGACATTGTAG
SP6 GATCCTCCCGAATTGACTAGTG
----------------------------------------------------------

PAC : Bibliothèque DeJong RPCI-5. Vecteur : pCYPAC2N (18,754 Ko). Résistance : Kanamycine 50ug/ml
séquençage final :
T7 CGGTCGAGCTTGACATTGTAG
SP6 GATCCTCCCGAATTGACTAGTG

Volume final : 50 ul utilisent environ 50 ng de l'ADN fourni.

Préparer un mélange réactionnel Taq contenant 200 uM de dNTP, 100 pmol d'amorce universelle, 10 mM Tris-HCl, pH8,3, 1,5 mM MgCl2, 50 mM KCl, 1,25 unités d'ADN polymérase Taq.

30 cycles de
94C pendant 1 min
62C pendant 1 min
72C pendant 2 minutes
Rallonge 72C pendant 8 minutes

Traitement des lames à la pepsine (pour le vieillissement des lames fraîches)

Traitement des lames à la pepsine (pour le vieillissement des lames fraîches)

- incuber 30' à 37°C dans 0,005% pepsine/0,01M HCl (stock)

- 5' à TA en tampon pour 50ml (5ml 10xPBS : 5ml 0.5M MgCl2 : 40ml H2O)

- 5' en paraformaldéhyde 4% à TA pour 50ml (5ml 10xPBS : 5ml 0.5M MgCl2 : 15ml

H20 : 25 ml de paraformaldéhyde 8%)

- 3 lavages en série éthanol (70%, 90% et 100%)

Extraction d'ADN à partir de YAC (mégalothèque CEPH)

- semer le YAC dans 5-10ml de YPD (avec ampicilline, 50ug/ml)
- incuber 2 jours à 30°C dans un agitateur
- fuge 5' a 3500RPM jeter le SN
- suspendre dans 0,5 ml de sorbitol 1M-0,1M EDTA (pH7,5)
- transfert en tube eppendorf
- ajouter 7ul de lyticase (solution mère : 10.000U/ml).
- incuber à 37°C pendant 30'
- fuger pendant 1', défaussez le SN.
- suspendre dans 0,5 ml de Tris-HCl 50 mM (pH 7,4) - EDTA 20 mM
- ajouter 50ul de SDS 10% mix
- à 65°C pendant 30'
- ajouter 0,2 ml de KAc 5M dans de la glace pendant 60'
- refuge pour 5'
- transférer le SN dans un tube eppendorf
- ajouter 1 vol d'isopropanol à TA
- mélanger laisser à RT par 5'
- fuger pendant 10 secondes, jeter le SN, laisser sécher le culot
- suspendre dans 0.3ml de TE (pH7.4)
- ajouter 15µl de RNAse A 1mg/ml à 37°C pendant 30'
- ajouter 30µl de Na Acet., mélanger
- précipiter avec 0,2 ml d'isopropanol
- fuger brièvement jeter le surnageant
- sécher le pellet au Savant pendant 5'
- suspendre dans 0,1-0,3 ml de TE (pH 7,4)
- fuger brièvement pour éliminer les matières insolubles
---------------------------------
YPD : (1 litre) : 10gr d'extrait de levure
20gr de peptone
---------------------------------
Autoclave pendant 30' lorsque la température est d'environ 50C ajouter
50 ml de glucose (40%, stérilisé par filtration)

NOTE : Résistance : BAC : Cloramphénicol (12,5 ug/ml) PAC : Kanamycine (50ug/ml)
Milieu LB (1 litre) : Extrait de levure Bacto 5 g Trypton Bacto 10 g NaCl 10 g H2O jusqu'à 1 litre. Autoclave.

(Nous sommes récemment passés à des kits commerciaux, qui donnent généralement plus d'ADN pur).

1. Cultiver des bactéries dans 10 ml de milieu bactérien contenant le bon antibiotique dans des tubes Falcon de 50 ml pendant 16/20 heures.
2. Centrifuger 7' à 4000 rpm.
3. Ajouter 300µl de GTE (Glucose 50mM, Tris 25mM pH=8, EDTA 10Mm)
4. Remettre complètement le culot en suspension.
5. Transférer la suspension cellulaire dans des tubes Eppendorf de 2,2 ml.
6. Ajouter 600 µl de solution de dénaturation fraîchement préparée (0,2 N NaOH, 1% SDS, température ambiante) ne pas vortexer, mélanger en retournant plusieurs fois, ne pas lyser plus de 5'. Le lysat doit apparaître visqueux.
7. Ajouter 500µl d'acétate d'ammonium 7.5M ne pas vortexer, mélanger immédiatement en retournant plusieurs fois laisser sur la glace pendant 10' inverser plusieurs fois pendant la période d'incubation.
8. Centrifuger à 13000 rpm pendant 20'
9. Verser le surnageant dans des tubes Eppendorf frais de 2,2 ml le surnageant n'est le plus souvent pas limpide et une seconde centrifugeuse à 14000 rpm pendant 10' doit être effectuée.
10. Verser le surnageant dans des tubes Eppendorf frais de 2,2 ml.
11. Ajouter le mélange d'isopropanol 700µl en retournant plusieurs fois.
12. Centrifuger à 14000 rpm pendant 20'.
13. Jeter le surnageant, le culot doit être à peine visible
14. Laver le culot avec 500µl d'EtOH à 70 %.
15. Centrifuger à 14000 rpm pendant 5'.
16. Jeter le surnageant ne pas laisser sécher le culot.
17. Remettre en suspension le culot dans 100µl de TE en scotchant les tubes.
18. Traiter avec la RNAse f.c. 100ug/ml : à 37°C pendant 30'.
19. Précipiter l'ADN avec 1/10 vol de NaAc et 3 vol d'éthanol
20. Incuber à -20°C pendant 20'
21. Fuge pendant 15' à 14000 rpm lavage avec 70% d'éthanol
22. Remettre en suspension dans TE (volume approprié)
23. Vérifiez le magasin de gel à 4°C
------
Avant étiquetage : fuger pendant 15' à 14.000 rpm

Amplification Alu-PCR

La PCR est réalisée en utilisant les amorces Alu suivantes (Liu et al., 1993) :

5' GGATT ACAGG YRTGA GCCA 3'
5' RCCAY TGCAC TCCAG CCTG 3' (Y=C/T R=A/G),

150 ng d'ADN génomique de l'hybride sont amplifiés dans un volume de 50µl.
Cycles :
- 5 min à 95°C
- 30 cycles comme suit :
1 min à 95°C
1 min à 65°C
4 min à 72°C
extension finale de 10 min à 72°C.

Vérifier la concentration des produits amplifiés sur gel. Une bonne amplification donne environ 200ng/ul
Étiquetez les produits en utilisant Nick-translation comme décrit (voir ci-dessous).

Réactifs pour PCR (congelés à conserver) :
- 10x dNTPs mélangent 2mM chacun, pH7.
- Tampon de réaction 10x (fourni généralement avec la Taq).

Marquage des sondes à la biotine par nick-translation

Marquage indirect (Biotine)

1. Ajouter dans un tube à centrifuger, sur de la glace :
- 1µg d'ADN
- 5µl 10x tampon de traduction de pseudo*
- Mélange de 5µl dNTP*
- Mélange de biotine 2,5µl*
- 5µl 0.1M bêta-mercaptoéthanol
- diluer (immédiatement avant utilisation) 1µl de DNAseI (2U/µl) dans 1ml d'eau distillée
- ajouter 10µl au mix de nick-translation : le DNAseI doit être calibré pour donner des fragments de 100-500bp
- ADN polymérase I 5U
- eau stérile distillée à 50µl

1. Ajouter dans un tube à centrifuger, sur de la glace :
- 1µg d'ADN
- Tampon 5µl 10x
- 1µl dACG (stock : 0.5mM)
- 0.5µl dUTP-Cy3 (Amersham, stock : 1mM)
- 5µl 0.1M bêta-mercaptoéthanol
- 0.5µl DNA pol.I (10U/µl)
- diluer (immédiatement avant utilisation) 1µl de DNAseI (2U/µl) dans 1ml d'eau distillée
- ajouter 10µl au mix de nick-tranlation : le DNAseI doit être calibré pour donner
fragments de 100-500 pb
- H2O --> un 50µl

1. Ajouter dans un tube à centrifuger, sur de la glace :
- 1µg d'ADN
- Tampon 5µl 10x
- 3µl dAGT (stock 0,5 mM)
- 1.5µl dCTP-FluorX (Amersham)
- 5µl 0.1M bêta-mercaptoéthanol
- 0.5µl DNA pol.I (10U/µl)
- diluer (immédiatement avant utilisation) 1µl de DNAseI (2U/µl) dans 1ml d'eau distillée
- ajouter 10µl au mix de nick-tranlation : le DNAseI doit être calibré pour donner
fragments de 100-500 pb
- H2O --> un 50µl
2. Incuber à 15°C pendant 2h
3. Placer à 4°C jusqu'à vérification sur gel.
4. Prélever 5µl d'aliquote de chaque échantillon, ajouter 5µl 2x de tampon de chargement. Exécuter sur du gel d'agarose à 1%. Chargez également un marqueur MW approprié (comme pCMVb-HaeIII). Inspectez le gel sur transilluminateur UV : les fragments doivent être compris entre 100 et 500 pb.
Si les fragments sont plus gros, ajoutez de la DNAseI supplémentaire aux échantillons, incubez pendant 10 minutes supplémentaires et vérifiez à nouveau.
5. Arrêter la réaction en ajoutant 4µl d'EDTA 0,5M (pas nécessaire si sur de la glace).

* tampon de traduction de pseudo (tampon 10x) :
0.5M Tris-HCl pH 7.8-8
50 mM MgCl2
0,5 mg/ml de BSA

* mélange de dNTP :
0,5 mM dTTP
0,5 mM dCTP
0.5mM dGTP

* mélange biotine-16-dATP
0,5 mM de dATP
0,5 mM de bio-16-dATP (Boehringer Mannheim)

Hybridation in situ en fluorescence (FISH)

1.Préparer 200µl/glissière de solution dénaturante (70% formamide déionisé/2xSSC)
2. Préchauffer les lames à 60°C sur une plaque thermobloc.
3.Mettre 200µl de solution de dénaturation sur chaque lame et incuber pendant exactement 2 min à 80°C sur une plaque thermobloc.
4.Déshydrater les lames dans 70, 90 et 100 % d'éthanol, 3 m à chaque fois (70 % d'éthanol à -20 °C).
5. Sécher les lames après déshydratation.

1. Précipiter l'ADN marqué (voir note) avec 10 & microg d'ADN humain Cot-1 (pas pour les séquences répétées), 3 & microg d'ADN de sperme de saumon, 1/10 vol d'acétate de Na 3M et 3 vol d'éthanol froid (-20 & C). Laisser à -80°C pendant 15 minutes. Essorez 15' (14 000 tr/min) à 4°C. Sécher complètement le culot au Savant fuge pendant quelques minutes
2.Préparer le mélange d'hybridation (10 µl par lame). Ajouter à un tube à essai : 5µl de formamide désionisé, 2µl de sulfate de dextrane (50% dans de l'eau distillée, autoclavée), 2µl d'eau distillée et 1µl de 20xSSC. Si plusieurs lames doivent être hybridées, un master mix peut être préparé.
3.Resuspendre le culot dans le mélange d'hybridation 10 et microl, en vortexant avec précision pendant 10 min
4.Dénaturer le mélange d'ADN à 80°C pendant 8 minutes et transférer à 37°C pendant 20 minutes pour effectuer le pré-annelage (pas pour les séquences répétées). Placer sur la glace jusqu'à utilisation.
REMARQUE : la quantité de sonde dépend du type de sonde : 20-50 ng pour l'ADN répétitif 500-600 ng pour les sondes de peinture, YAC, PAC, BAC, cosmides et plasmides 1000 ng pour les très petites sondes (ex. Plasmides, ADNc).

1.Appliquer le mélange d'hybridation 10 et microl sur des lames dénaturées, en évitant les bulles d'air
2.Couvrir avec un joint de lamelle propre 24x24mm avec du ciment en caoutchouc
3.Incuber dans une chambre humide à 37°C pendant la nuit

Lavage et détection post-hybridation

Ne laissez sécher les lames dans aucun passage ! Tous les lavages se font en bocal Choplin.

1.Retirer les lamelles et laver 3 fois pendant 5 minutes dans une solution préchauffée (forme à 50%. / 2xSSC) dans un bocal Choplin dans un bain-marie agité à 42°C (nous gardons généralement ce premier lavage)
2. Laver 3 fois pendant 5' dans 0,1xSSC préchauffé au bain-marie à 60°C, puis passer à l'étape 6 si un étiquetage direct a été effectué
3.Appliquez 200 et microl de solution de blocage par lame (3% BSA/4xSSC/0,1 Tween 20) avec une lamelle 24x50mm, transférez les lames dans une chambre humide, incubez pendant 30 'à 37°C.
4.Diluer la solution mère d'avidine-Cy3 (1:300) dans un tampon de détection (1%BSA/1xSSC0/0,1 Tween 20) (Cy3 est d'Amersham Cy3 est plus fort et plus stable que les autres fluorochromes utilisent le même filtre pour la rhodamine, ou un spécifique). Laissez glisser les lamelles et appliquez une solution de détection 200µl par lame. Couvrir avec des lamelles 24x50mm. Transférer les lames dans une chambre sombre et humide. Incuber à 37°C pendant 30 min.
5.Retirez les lamelles et rincez les lames 3 fois pendant 5 min dans une solution de lavage préchauffée (4xSSC / 0,1 Tween 20) au bain-marie à 42°C.
6. Contre-coloration avec DAPI (200ng/ml en 2xSSC)
7.Appliquez 30 microl de support de montage anti-décoloration* et couvrez avec des lames couvre-objets de 24 x 50 mm pouvant être conservées pendant des semaines dans l'obscurité à 4 °C.

* Milieu de montage anti-décoloration (pour 10ml) :
- 0,233g de DABCO (1,4-diazabicyclo-(2.2.2)octane, Sigma)
- 800µl H2O
- 200µl 1M Tris-HCl
- 9 ml de glycérol

Les références

Archidiacono N, Antonacci R, Forabosco A, Rocchi M : Préparation de sondes de peinture de chromosomes humains à partir d'hybrides de cellules somatiques. Dans : Methods in Molecular Biology, Vol. XX : Protocoles d'hybridation in situ. Choo KHA, éd. Totowa, New Jersey : Humana Press Inc., 1-13 (1994)

Archidiacono N, Marzella R, Finelli P, Antonacci R, Jones C, Rocchi M : Caractérisation des hybrides chimpanzé-hamster par peinture chromosomique. Somatique. Cellule. et Mol. Genet. 20:439-442 (1994)

Antonacci R, Marzella R, Finelli P, Lonoce A, Forabosco A, Archidiacono N, Rocchi M : Un panel de bibliothèques de peintures sous-chromosomiques représentant plus de 300 régions du génome humain. Cytogenète. Cellule. Genet. 68:25-32 (1995)

Liu P, Siciliano J, Seong D, Craig J, Zhao Y, de Jong PJ, Siciliano MJ : amorces PCR Dual Alu et conditions pour l'isolement de sondes de peinture de chromosomes humains à partir de cellules hybrides. Cancer Genet Cytogenet 65:93-99 (1993).

Muller S, Koehler U, Wienberg J, Marzella R, Finelli P, Antonacci R, Rocchi M, Archidiacono N: Cartographie comparative d'hybridation in situ en fluorescence des chromosomes de primates avec des sondes générées par Alu -PCR à partir d'hybrides de cellules somatiques humains/rongeurs. Chrome. Rés. 4:38-42 (1996)

Spurr NK, Bashir R, Bushby K, Cox A, Cox S, Hildebrandt F, Hill N, Kao FT, Krols L, Marzella R, Miller N, Nothwang HG, Rocchi M, Sarfarazi M, Stratakis CA, Wallgren-Pettersson C, Naylor S : Rapport des quatre ateliers internationaux sur la cartographie du chromosome 2 humain 1996. Cytogenet. Cellule. Genet. 73:255-273 (1996)

Rocchi M, Antonacci R, Marzella R, Finelli P, Cassano C, Lonoce A, Cino C, Forabosco A, Archidiacono N : bibliothèques de peintures sous-chromosomiques (SCPL) à partir d'hybrides de cellules somatiques. Chromosomes Aujourd'hui Vol. 12 sous presse (1996)

Gianfrancesco F, Esposito T, Ruini L, Houlgatte R, Nagaraja R, D'Esposito M, Rocchi M, Auffray C, Schlessinger D, D'Urso M, Forabosco F : Cartographie de 59 marqueurs du gène EST dans 31 intervalles couvrant le X humain chromosome. Gène sous presse

Marzella R, Viggiano L, Ricco A, Tanzariello A, Fratello A, Archidiacono N, Rocchi M : Un panel d'hybrides de rayonnement et de clones YAC spécifiques du chromosome 5. (Ces hybrides ont également été caractérisés par des STS) . Soumis pour publication.


Vendredi 19 octobre 2007

Mes solutions aux devoirs 2

Question:
Quelque part sur Internet se trouve une base de données d'enzymes de restriction.
une. Où est-il situé? Quelle est l'URL du fichier de base de données qui pourrait être utilisé avec le logiciel GCG ?
Réponse : La base de données des enzymes de restriction se trouve à REBASE.
L'URL du site est http://rebase.neb.com/rebase/rebase.html
L'URL du fichier de base de données pouvant être utilisé avec le logiciel GCG est http://rebase.neb.com/rebase/link_gcg

b. À quoi ressemble une entrée typique pour le fichier d'enzyme de restriction formaté pour être utilisé avec le programme MacVector ?
Réponse : Rebase Format #19 est utilisé avec le programme MacVector.
Chaque entrée est composée de lignes. Différents types de lignes avec leurs propres formats sont utilisés pour représenter les données. Chaque ligne commence par un code de ligne à deux caractères qui indique le type d'informations fournies dans la ligne. “//” sert de délimiteur entre les entrées individuelles.

Chaque entrée de la base de données contient les champs suivants :
Nom de l'enzyme d'identification
Type d'enzyme ET
Nom du micro-organisme du système d'exploitation
Prototype TP
Séquence de reconnaissance RS, site coupé
Site de méthylation MS (type)
CR sources commerciales pour l'enzyme de restriction
Sources commerciales CM pour la méthylase
RN [compte]
auteurs RA
RL jour, vol, pages, année, etc.
//
Exemple d'une entrée type :
ID M.BamHII
ET M
OS Bacillus amyloliquefaciens H
PT BamHII
RS GGATCC, ?
MS 5
IA [1]
RA Connaughton J.E., Vanek P.G., Chirikjian J.G.
RL J. Cell Biol. 107:535a-535a (1988).
//

c. Comment la base de données (formatée pour MacVector) est-elle organisée ?
Réponse : La base de données est organisée sous la forme d'un fichier plat. Il s'agit d'une base de données texte uniquement sans graphiques. Il est au format Bairoch. Il contient une liste alphabétique des enzymes de restriction de types I, II et III ainsi que des méthylases dans un format compatible avec un large éventail de banques de données (PROSITE, ENZYME, SwissProt, EMBL, ECD, EPD, HAEMB). Chaque entrée est composée de lignes. Différents types de lignes avec leurs propres formats sont utilisés pour représenter les données. Chaque ligne commence par un code de ligne à deux caractères qui indique le type d'informations fournies dans la ligne. “//” sert de délimiteur entre les entrées individuelles.

1. Quel est le délimiteur entre les entrées d'enzymes de restriction individuelles ? Comment l'ordinateur (ou vous) sait-il quand l'information d'une enzyme de restriction s'arrête et qu'une autre commence ?
Réponse : Le délimiteur entre les entrées d'enzymes de restriction individuelles est “//”.

2. Ce format est-il similaire au format utilisé par toute autre base de données ? Lequel?
Réponse : J'ai comparé les données au format MacVector avec les données au format DNA Strider dans REBASE. Bien que similaire dans le fait que ce format fournit également des informations sur les enzymes de restriction et que les données sont organisées au format FASTA, il existe également quelques différences, telles que la séparation des champs, etc., le nombre de champs, etc.

MacVector
ADN Strider
Chaque entrée a beaucoup plus de champs descriptifs que le nom de l'enzyme DNA Strider, le type d'enzyme, le nom de l'organisme, le prototype, la séquence de reconnaissance, le site de coupure, le site de méthylation et les sources commerciales.
Chaque entrée ne comporte que deux champs descriptifs : nom de l'enzyme, séquence de reconnaissance avec site de clivage. Les champs individuels sont séparés par une virgule (,)
L'entrée individuelle est séparée par “//”
Les entrées individuelles commencent sur une nouvelle ligne
Format de fichier plat
Format de fichier plat

Ensuite, j'ai comparé le format MacVector dans la base de données REBASE avec la base de données GenBank : bien que le format soit similaire en ce sens que les deux bases de données avaient un délimiteur commun “//”, la plupart des autres attributs étaient très différents.
MacVector
GenBank
Chaque entrée commence par le champ ID.
Chaque entrée commence par le champ locus.
Chaque champ est représenté par un code de ligne à deux caractères tel que ID, OS, etc.
Chaque champ est représenté par un ou plusieurs mots descriptifs tels que définition, lieu, etc.
Les informations ne sont disponibles qu'au format FASTA.
Les informations sont disponibles dans un large éventail de formats tels que FASTA, XML, Graphics, etc.
Les entrées individuelles sont séparées par “//”
Les entrées individuelles sont séparées par “//”
Il contient des informations sur le site de restriction de l'enzyme et ne contient aucune information sur la séquence d'acides aminés ou de nucléotides
Cette base de données contient des informations sur la séquence nucléotidique. S'il code pour une protéine exprimée, il contient également les informations traduites.

Questions de recherche documentaire
1) Sélectionnez une protéine et recherchez les entrées pour cette protéine dans la base de données ADN GenBank, la base de données SwissProt et la base de données PDB Protein. Répertoriez les attributs ou caractéristiques communs aux bases de données et ceux qui leur sont propres.
Réponse : J'ai recherché dans les bases de données la sous-unité β de l'hormone folliculostimulante humaine.
Résultats de l'APB :
URL : http://www.pdb.org/pdb/explore.do?structureId=1FL7
Résultats de SwissProt :
URL : http://au.expasy.org/uniprot/P01225
Résultats GenBank :
URL : http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=EF198021

GenBank
SwissProt
APD
Le code d'identification de la protéine est le locus ou le numéro d'accession qui est généralement un alphanumérique à huit chiffres.
Le code d'identification est appelé numéro d'accession primaire. Il s'agit généralement d'un alphanumérique à six chiffres.
Le code d'identification unique de la protéine est petit, généralement un alphanumérique à quatre chiffres.
Genbank contient les informations suivantes dans chaque entrée : locus, définition, numéro d'accession, version, mots-clés, source, organisme, références, gène, ARNm et CDS.
SwissProt contient les informations suivantes dans chaque entrée : nom de l'entrée, numéro d'accès primaire, informations sur le nom et l'origine de la protéine, références, liens vers des références croisées et la séquence d'acides aminés.
La PDB contient les informations suivantes dans chaque entrée : titre, références, historique, informations expérimentales, description moléculaire et informations sur la structure de la protéine.
GenBank donne la séquence d'ADN de la protéine. Il contient également la séquence traduite de la séquence, si elle est exprimée.
SwissProt donne la séquence d'acides aminés de la protéine. D'autres informations sur la séquence peuvent être trouvées en suivant les liens.
PDB donne des informations structurelles (3D) détaillées sur la protéine avec des images et des chiffres pour aider à visualiser la molécule. Il contient également la séquence d'acides aminés.
GenBank ne fournit pas de liens pour les références croisées.
SwissProt a de nombreux liens qui permettent un référencement croisé facile.
PDB permet également le référencement croisé via des “liens externes”.
GenBank est une base de données beaucoup plus grande que SwissProt ou PDB.
Swissprot n'est pas une base de données aussi grande que GenBank, mais est plus grande que PDB.
PDB est une base de données relativement petite car de nombreuses protéines disponibles chez SwissProt et GenBank n'ont pas pu être trouvées ici.
Les informations peuvent être affichées dans un large éventail de formats tels que FASTA, GenBank, XML, Graphical, etc.
Les informations de séquence ne sont disponibles que sous deux formats : SwissProt et FASTA. Il n'y a pas de représentation graphique des données.
Les informations sur la séquence sont disponibles au format FASTA. Cependant, il existe également une large représentation graphique des données.


Voir la vidéo: Deoxynucleotide dNTP vs Dideoxynucleotid ddNTP (Février 2023).